BIOL 1114 TCC Actual and Predicted Sequences in The Database Questions

BIOL 1114 TCC Actual and Predicted Sequences in The Database Questions

Description

 

 

 

 

Unformatted Attachment Preview

1. In a separate tab or window, open the NCBI BLAST home page https://blast.ncbi.nlm.nih.gov/Blast.cgi or search the internet for NCBI Blast, then choose Nucleotide Blast (blastn) CGAGGGACCTTTACGGCGTAATCCTGGAAACCATGACAAATCCAGAACCCCAAGGCTCCCCTCTT CAGCTGATGTAGAATTTTGCCTG AGTTTGACCCATGGAAGGATTTGCTAGTCCACTTACTGGGATAGCGGATGCCTCTCAAAGAGCAT GCACAATGCCTTGCACATCTATAT GAATGGAACAATGTCCCAGGCAGGGATCTGCCAACGATCCTATCTTCCTTCTTCACCATGCATTTGT TGACAGTATTTTTGAGCAGTGG CTCCGAAGGCACCGTCCTCTTCAAGAAGTTTATCCAGAAGCCAATGCACCCATTGGACATAACCG GGAATCCTACATGGTTCTTATACC ACTGTACAGAAATGGTGATTTCTTTATTTCATCCAAAGATCTGGGCTATGACTATAGCTATCTACAAG ATTCAGACCCAGACTCTTTTCAA GACTACATTAAGTCCTATTTGGAACAAGCGAGTCGGATCTGGTCATGGCTCCTTGGGGCGGCGAT GGTAGGGGCCGTCCTCACTGCC CTGCTGGCGGGCTTGTGAGCTTGCTGTGTCGTCACAAGAGAAAGCAGCTTCTGAAGAAAAGCAG CCACTCCTCATGGAGAAAGAGGA TTACCACAGCTTGTATCAGAGCCATTTATAAAAGGCTTAGGCAATAGAGTAGGGCCAAAAAGCCT GACCTCACTCTAACTCAAAGTAATG TCCAGGTTCCCAGAGAATATCTGCTGGTATTTTTCTGTAAAGACCATTTGCAAAATTGTAACCTAAT ACAAAGTGTAGCCTTCTTCCAACT CAGGTAGAACACACCTGTCTTTGTCTTGCTGTTTTCACTCAGCCCTTTTAACATTTTCCCCTAAGCC CATATGTCTAAGGAAAGGATGCT ATTTGGTAATGAGGAACTGTTATTTGTATGTGAATTAAAGTGCTCTTATTTTAAAAAATTGAAATAAT TTTGATTTTTGCCTTCTGATTATTTA AAGATCTATATATGTTTTATTGGCCCCTTCTTTATTTTAATAAAACAGTGAGAAATCT Copy the DNA sequence above using one of three ways. Use your mouse to highlight your sequence. Click the right mouse button and select Copy. Open the Edit menu in web browser and select Copy. Use the keyboard commands (Ctrl + C for Windows, Command + C for Mac). Paste your sequence in the top BLAST text box, using one of three methods: Click the right mouse button and select Paste. Open the Edit menu in web browser and select Paste. Use the keyboard commands (Ctrl + V for Windows, Command + V for Mac). Do not change any other settings on the page and click the BLAST button on the bottom left of the screen. You should be aware that the NCBI web changes regularly. Although the information is current, the NCBI web page may appear slightly different. Answer the following questions based on the displayed results. Keep the results open as you complete this lab. BLAST is a website that allows scientists to post, search and ___ nucleotide sequences. 1 Discuss 2 divide 3compare 4 mutate 2. You entered what type of sequence? This is also listed near the top under molecule type. DNA lipid protein carbohydrate 3. What is the listed Job Title in bold near the top? Protein Sequence Nucleotide Sequence BLASTN None of these appear 4. Which of the following numbers is closes to the Query Length? This is also listed near the top and reflects the number of letters in the cut and paste. 100.4 104.4 1,040 10,404 5. According to the list, there are both actual and predicted sequences in the database. True False 6. Which one statement is true? There is only one functioning version of tyrosinase in humans. There are many functioning versions of this gene, this contributes to inheritance patterns. Primate genes for tyrosinase have very little similarity. None of these are true. 7. Under the Descriptions tab what is the first entry? Homo sapiens tyrosinase Homo sapiens recombinase Pan paniscus tyrosinase Gorilla gorilla gorilla tyrosinase 8. For the top entry, what is the Query Cover? Notice all of the column titles. 0% 99.26% 100% 110% 9. What is the E value for all listed sequences? 100 Between 100-1900 0.0 All of these are listed. 10. What organism is Homo sapiens? Bonobo human sablefish gorilla 11. Under the alignments tab, the sequence you entered aligns with the known sequence perfectly — every ACT and G aligns exactly . True False 12. What is the best description of tyrosinase based on what you learned in previous modules? It is an enzyme. It is not a protein. It is a DNA sequence. All of these are true of tyrosinase. 13. Travel to the Sequence ID: NM_000372.5 linked here https://www.ncbi.nlm.nih.gov/nucleotide/NM_000372.5?report=genbank&log$=nuclali gn&blast_rank=1&RID=7V2HUCEG013 and on the page. How many base pairs are listed in the top line for this sequence? 2000 2062 2066 None of these are listed. 14. Look at the organism listing that appears. This list correctly reflects human organisms are which of these? Prokaryotes Albinism Eukaryotes Reptiles 15. Tyrosinase is being studied and written about by scientists. Every PUBMED link listed in the column will take you to a research paper. What can you tell by looking at the Journal article titles? This gene has no application in medical studies. This gene is involved in eye color. This gene has not been studied since the 1980s. This gene has not been sequenced. 16. Scroll down to the CDS section (https://www.ncbi.nlm.nih.gov/nuccore/NM_000372.5?from=80&to=1669) . What is listed there? The same sequence you entered in the first box. The transcribed mRNA nucleotides. The translation with amino acids listed as single letters. There is nothing listed there. 17. NCBI BLAST results are updated regularly with new research findings. True False 18. Choose one of the PUBMED articles on the tyrosinase page https://www.ncbi.nlm.nih.gov/nucleotide/NM_000372.5?report=genbank&log$=nuclali gn&blast_rank=1&RID=7V2HUCEG013. Open in a new tab and summarize just the abstract in 3-5 clear sentences using scientific vocabulary.
Purchase answer to see full attachment

Explanation & Answer:

18 Questions